| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.106137 |
| Chromosome: | chromosome 1 |
| Location: | 2841774 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g017100 | (1 of 1) IPR002123//IPR029058 - Phospholipid/glycerol acyltransferase // Alpha/Beta hydrolase fold | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCTCAGCCCCCGCCCAACTCCATTCCTAC |
| Internal bar code: | GCCAGGCGGCCACGCGCGGCAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 438 |
| LEAP-Seq percent confirming: | 87.628 |
| LEAP-Seq n confirming: | 1027 |
| LEAP-Seq n nonconfirming: | 145 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCTTGCCGTACCTGTAGCC |
| Suggested primer 2: | TTGCAACTCGTTTCCTACCC |