| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.106170 |
| Chromosome: | chromosome 2 |
| Location: | 2739357 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g093850 | (1 of 1) IPR000104//IPR000595//IPR001611//IPR003591//IPR018490 - Antifreeze protein, type I // Cyclic nucleotide-binding domain // Leucine-rich repeat // Leucine-rich repeat, typical subtype // Cyclic nucleotide-binding-like | 5'UTR_intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTTTCGTGACTGTGGGGTGGGGGCGTGTG |
| Internal bar code: | CCGGGTCGCCTGGGCGGTTCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 682 |
| LEAP-Seq percent confirming: | 97.7186 |
| LEAP-Seq n confirming: | 514 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AATCGCGACAGAGAAAAGGA |
| Suggested primer 2: | CTGCTTGATGGTCGTCTCAA |