| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.106192 |
| Chromosome: | chromosome 16 |
| Location: | 1733403 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g654900 | (1 of 66) 2.7.12.1 - Dual-specificity kinase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTCTTGAGGAGCACAGGCACCGGGATCCC |
| Internal bar code: | AGGCTCTACCGGCGGGGTCTAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 653 |
| LEAP-Seq percent confirming: | 98.4224 |
| LEAP-Seq n confirming: | 3556 |
| LEAP-Seq n nonconfirming: | 57 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATACGACGAACGACCTACCG |
| Suggested primer 2: | TCAACGCCTCTTCTAGGCAT |