| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.106237 |
| Chromosome: | chromosome 8 |
| Location: | 1416459 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g364300 | FAP29 | (1 of 3) PTHR10338//PTHR10338:SF110 - VON WILLEBRAND FACTOR, TYPE A DOMAIN CONTAINING // VON WILLEBRAND FACTOR A DOMAIN-CONTAINING PROTEIN 5A; von Willebrand Factor Type A Domain Flagellar Associated Protein 29 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATCGCCATAAAGACAGGGACACGAAGACG |
| Internal bar code: | TATGAGCCACCACTTCGGGAAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 350 |
| LEAP-Seq percent confirming: | 98.0165 |
| LEAP-Seq n confirming: | 16999 |
| LEAP-Seq n nonconfirming: | 344 |
| LEAP-Seq n unique pos: | 63 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTAGTGGATCAGAGGACGC |
| Suggested primer 2: | CCCACACACACTCACACACA |