Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.106258 |
Chromosome: | chromosome 1 |
Location: | 3051206 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g018750 | DIV155 | (1 of 44) IPR000048 - IQ motif, EF-hand binding site | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGGTCCATCACTCGTCAGGCCGCACTCCA |
Internal bar code: | ACTGATCCGTCTGGAGTTGCGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 547 |
LEAP-Seq percent confirming: | 99.2516 |
LEAP-Seq n confirming: | 3846 |
LEAP-Seq n nonconfirming: | 29 |
LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACATCAGCGAGGAGCAATCT |
Suggested primer 2: | CTTCTCACCCAGCCATCTGT |