| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.106261 |
| Chromosome: | chromosome 9 |
| Location: | 3568265 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g390023 | CRR1 | Copper responsive regulator 1; (1 of 2) IPR004333//IPR020683 - Transcription factor, SBP-box // Ankyrin repeat-containing domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACCGAACGCCTCCTTGCCCGCACTTGTGT |
| Internal bar code: | CGGTGGTTGGTCCCGATGTACA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1062 |
| LEAP-Seq percent confirming: | 99.8056 |
| LEAP-Seq n confirming: | 8216 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACCCAGGCCTTCTACCCTT |
| Suggested primer 2: | GTACGCACCACCAGTACACG |