| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.106433 |
| Chromosome: | chromosome 1 |
| Location: | 2445849 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g013650 | (1 of 3) PF15612 - WSTF, HB1, Itc1p, MBD9 motif 1 (WHIM1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCAACCGCAACCTCCTGTGACATCAACCT |
| Internal bar code: | GAGCGCTCAGACGGTTTGCTAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 213 |
| LEAP-Seq percent confirming: | 34.2723 |
| LEAP-Seq n confirming: | 73 |
| LEAP-Seq n nonconfirming: | 140 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AATATCACCAAAAGCGACGG |
| Suggested primer 2: | ACAGATTCAGGCCATTGAGC |