Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.106584 |
Chromosome: | chromosome 2 |
Location: | 5757304 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g110550 | (1 of 24) PTHR10641 - MYB-LIKE DNA-BINDING PROTEIN MYB | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGGACGCATGGCTCCGCTCCGCTGCGCCT |
Internal bar code: | ACATGCCCCTCGTCCTTTCCCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 625 |
LEAP-Seq percent confirming: | 99.5273 |
LEAP-Seq n confirming: | 2948 |
LEAP-Seq n nonconfirming: | 14 |
LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCATCCCCACTCAGTGCTAT |
Suggested primer 2: | GAGGCTGCATTAGCCAGAAC |