| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.106592 |
| Chromosome: | chromosome 16 |
| Location: | 5348764 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g681800 | IPK | (1 of 3) 2.7.1.159 - Inositol-1,3,4-trisphosphate 5/6-kinase / IP56K; Inositol 1%252C3%252C4-trisphosphate 5/6-kinase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTTCGCCGCGCGGCCCCCAGCTTCGGATG |
| Internal bar code: | GGGGGACTAATACGATAAGATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 407 |
| LEAP-Seq percent confirming: | 99.7128 |
| LEAP-Seq n confirming: | 8332 |
| LEAP-Seq n nonconfirming: | 24 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACACCAACACCATCTGGGTC |
| Suggested primer 2: | ACCCCAAACTGACTGTCGTC |