| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.106702 |
| Chromosome: | chromosome 1 |
| Location: | 5737616 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g040950 | (1 of 1) PF02816//PF13519 - Alpha-kinase family (Alpha_kinase) // von Willebrand factor type A domain (VWA_2) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGTCGTACACCGCGGCCGTACGGCTGCCGT |
| Internal bar code: | ACCAACGGTCAGCGGACCGTAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 661 |
| LEAP-Seq percent confirming: | 99.4556 |
| LEAP-Seq n confirming: | 1827 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACATGGCTATGCCCTTGAAC |
| Suggested primer 2: | GCAGTACCAGCCGTCCTATC |