| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.106714 |
| Chromosome: | chromosome 1 |
| Location: | 5261206 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g036750 | DMA1 | (1 of 1) 2.1.1.72 - Site-specific DNA-methyltransferase (adenine-specific) / Restriction-modification system; Putative DNA methylase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTAATGGCAGCGTGGGCCGACGTGAGTAGC |
| Internal bar code: | CACCGGGCGCCCCAGGCCAGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 616 |
| LEAP-Seq percent confirming: | 97.5356 |
| LEAP-Seq n confirming: | 2533 |
| LEAP-Seq n nonconfirming: | 64 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATTGAGCGCTCGTGAACTTT |
| Suggested primer 2: | GTCTCGCTGTGCATTCGTAA |