Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.106732 |
Chromosome: | chromosome 10 |
Location: | 3254113 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g443050 | PFH3,PHX15,P4H3 | Prolyl 4-hydroxylase 3; (1 of 14) K00472 - prolyl 4-hydroxylase (E1.14.11.2) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGGTAGCCCGTATACCTCAAACGGGTACC |
Internal bar code: | TCTCGTATCAATCTGTTAAGAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 645 |
LEAP-Seq percent confirming: | 99.7123 |
LEAP-Seq n confirming: | 2426 |
LEAP-Seq n nonconfirming: | 7 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTCGTTATCTAAGCGCCTGC |
Suggested primer 2: | TCCATGGTTCAAATGGGTTT |