| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.106925 |
| Chromosome: | chromosome 4 |
| Location: | 1730902 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g212401 | UBC15 | (1 of 2) K10586 - baculoviral IAP repeat-containing protein 6 (apollon) (BIRC6, BRUCE); E2 Ubiquitin conjugating enzyme | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTTCTGCTGCGCTTGCATGTGTCATAAGA |
| Internal bar code: | TCGAACCGAATCGGGCGGACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 657 |
| LEAP-Seq percent confirming: | 99.1228 |
| LEAP-Seq n confirming: | 113 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACAGGATGCACTGACGACTG |
| Suggested primer 2: | GCGTGTGTGTGTGTGTGTGT |