Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.106985 |
Chromosome: | chromosome 5 |
Location: | 1079935 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre05.g246100 | (1 of 1) IPR019887 - Transcription regulator AsnC-type, C-terminal | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAAGACAGCGGGCGGCCATGCCATACGCAC |
Internal bar code: | AAGTCGGGGGTATCAGTGGGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 696 |
LEAP-Seq percent confirming: | 94.231 |
LEAP-Seq n confirming: | 6893 |
LEAP-Seq n nonconfirming: | 422 |
LEAP-Seq n unique pos: | 33 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AATCCCGCAGTACTGTGTCC |
Suggested primer 2: | CCGTAACCCCAGTTCTACGA |