| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.107018 |
| Chromosome: | chromosome 1 |
| Location: | 6036935 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g042750 | ACH1 | (1 of 1) 4.2.1.3 - Aconitate hydratase / Citrate(isocitrate) hydro-lyase; Aconitate hydratase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGGCGCCCCACGCCTGCGCATTTCGGCTT |
| Internal bar code: | TGAGGCGCGCTTGGATACCGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 810 |
| LEAP-Seq percent confirming: | 98.5816 |
| LEAP-Seq n confirming: | 2502 |
| LEAP-Seq n nonconfirming: | 36 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGCATGAGCTTTGAGTGGA |
| Suggested primer 2: | TTATGATGGTTTGCGTGCAT |