| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.107065 |
| Chromosome: | chromosome 11 |
| Location: | 3797986 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g483400 | ELG10 | Exostosin-like glycosyltransferase 10; (1 of 2) IPR000742//IPR004263//IPR013111 - EGF-like domain // Exostosin-like // EGF-like domain, extracellular | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCGGGTGCGGGGTTCTGCTGGGGCAGCTG |
| Internal bar code: | ATAAAGGTGAACGCGTGGAACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 656 |
| LEAP-Seq percent confirming: | 98.3898 |
| LEAP-Seq n confirming: | 1161 |
| LEAP-Seq n nonconfirming: | 19 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTATGCTCAACCACTGGGG |
| Suggested primer 2: | GAGCATGTGTTGAATGTGGG |