Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.107090 |
Chromosome: | chromosome 13 |
Location: | 3595015 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g588350 | (1 of 1) IPR000403//IPR011009 - Phosphatidylinositol 3-/4-kinase, catalytic domain // Protein kinase-like domain | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACACGTGACCTGCCCTTCGGCCGCCCTTG |
Internal bar code: | CTACACGAGAGTATGTGCGTGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 564 |
LEAP-Seq percent confirming: | 90.248 |
LEAP-Seq n confirming: | 5423 |
LEAP-Seq n nonconfirming: | 586 |
LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCCATCGCAAGTTAAACGAT |
Suggested primer 2: | CAAACACATGCCAACCAGTC |