Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.107097 |
Chromosome: | chromosome 9 |
Location: | 1915982 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g395250 | MOT5,FAP36 | (1 of 1) PTHR21532:SF0 - COILED-COIL DOMAIN-CONTAINING PROTEIN 104; Flagellar Associated Protein 36 | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGGTGGGGGGTGGGGGGTGGGGTGGAGCG |
Internal bar code: | AGGGTAGATTGTATAGGAGGAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 521 |
LEAP-Seq percent confirming: | 57.6159 |
LEAP-Seq n confirming: | 261 |
LEAP-Seq n nonconfirming: | 192 |
LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCTTTACCTCTTTGCCTCCC |
Suggested primer 2: | GAGTCGTACTTGGCCTGCTC |