| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.107162 |
| Chromosome: | chromosome 3 |
| Location: | 735968 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g146127 | FAP96 | (1 of 1) PTHR31144:SF1 - UPF0602 PROTEIN C4ORF47; Flagellar Associated Protein 96 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGAATCATGACGCCGCGCGGAAAGCGGAGA |
| Internal bar code: | GGGCTCGATGTTGCATGGGTGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 513 |
| LEAP-Seq percent confirming: | 90.2124 |
| LEAP-Seq n confirming: | 2931 |
| LEAP-Seq n nonconfirming: | 318 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACAAGGTCGCAGGAAGAGAA |
| Suggested primer 2: | ACTCTACACACCGTCCCGTC |