| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.107166 |
| Chromosome: | chromosome 11 |
| Location: | 1523426 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467749 | (1 of 1) 1.13.11.60 - Linoleate 8R-lipoxygenase / 7,8-linoleate diol synthase (bifunctional enzyme) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGGCAATATGACTGCAATATGTGATAAGG |
| Internal bar code: | AAATATTCCGGAGGTTAAAGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 762 |
| LEAP-Seq percent confirming: | 98.445 |
| LEAP-Seq n confirming: | 1836 |
| LEAP-Seq n nonconfirming: | 29 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGGGTTTTATTTGCGCTGT |
| Suggested primer 2: | TTAACGTCCACTAGGACGGG |