| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.107211 |
| Chromosome: | chromosome 13 |
| Location: | 641154 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g565950 | (1 of 4) IPR001841//IPR018957 - Zinc finger, RING-type // Zinc finger, C3HC4 RING-type | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGAGCGTCGAGAAACGCGGAGCAGCGCCCG |
| Internal bar code: | AATAGTGGCTTTATTCCGGCCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 586 |
| LEAP-Seq percent confirming: | 99.4502 |
| LEAP-Seq n confirming: | 20622 |
| LEAP-Seq n nonconfirming: | 114 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAGCGCGTGTATCTTCATA |
| Suggested primer 2: | CCTTACCCTGTCCCATCAGA |