Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.107227 |
Chromosome: | chromosome 7 |
Location: | 2370074 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g328350 | FAP207 | Flagellar Associated Protein 207; (1 of 14) PF02493 - MORN repeat (MORN) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCATGTCAGCAAGCCATCCAGCGAGAACAG |
Internal bar code: | CCCGGACGCTCCTATATAAGGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 267 |
LEAP-Seq percent confirming: | 97.6562 |
LEAP-Seq n confirming: | 125 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCTGACCGGTTTAGAGCTTG |
Suggested primer 2: | GTGTCCGTGTGTGTTTGGAG |