| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.107275 |
| Chromosome: | chromosome 2 |
| Location: | 6940327 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g120100 | RBCS1 | (1 of 2) K01602 - ribulose-bisphosphate carboxylase small chain (rbcS); Ribulose-1%252C5-bisphosphate carboxylase/oxygenase small subunit 1, chloroplastic | 5'UTR_intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGCACTGGGAAGCCAGTAGCAGCGCGCTC |
| Internal bar code: | GGACAGTATTGCATACGCTGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 234 |
| LEAP-Seq percent confirming: | 99.0632 |
| LEAP-Seq n confirming: | 423 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAAAGTGGTTCAGTCAGCGA |
| Suggested primer 2: | GCAGGTCCCTCTTGTAACCA |