Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.107276 |
Chromosome: | chromosome 9 |
Location: | 6284890 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g406500 | (1 of 1) PF07814 - Wings apart-like protein regulation of heterochromatin (WAPL) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCTCGGCACGCGACCTTTCACCCAACATA |
Internal bar code: | GTTGGTTGCGTCGGGCGCGTGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 177 |
LEAP-Seq percent confirming: | 67.333 |
LEAP-Seq n confirming: | 1179 |
LEAP-Seq n nonconfirming: | 572 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCTGCTCATCAACCTCACCT |
Suggested primer 2: | ACACACCCTCCACACACTCA |