| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.107281 |
| Chromosome: | chromosome 7 |
| Location: | 1796990 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g325724 | PTP1 | Protein tyrosine phosphatase 1; (1 of 1) K18078 - protein tyrosine phosphatase domain-containing protein 1 [EC:3.1.3.-] (PTPDC1) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACCTGCCTGATCATTTTGCCATCAATATC |
| Internal bar code: | GCAAGGCAACCCGGACGATCTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 618 |
| LEAP-Seq percent confirming: | 98.7784 |
| LEAP-Seq n confirming: | 1132 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAAGCTTGCATGTGAGGACG |
| Suggested primer 2: | AAAGACTCGGGGTCGTAGGT |