Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.107333 |
Chromosome: | chromosome 2 |
Location: | 6178716 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g113750 | (1 of 6) PTHR22916//PTHR22916:SF9 - GLYCOSYLTRANSFERASE // SUBFAMILY NOT NAMED | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATCGATGGCGCATGCCAGGTGGGGTTGAC |
Internal bar code: | AGACGGTATCGAAGTTTTCGGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 406 |
LEAP-Seq percent confirming: | 99.5935 |
LEAP-Seq n confirming: | 735 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAACATGCTGCACCACAAG |
Suggested primer 2: | AATGTCCAGGTCAGGCGTTA |