Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.107348 |
Chromosome: | chromosome 16 |
Location: | 1169965 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g650600 | MST1 | Mastigoneme-like flagellar protein; (1 of 4) IPR009030//IPR011641 - Insulin-like growth factor binding protein, N-terminal // Tyrosine-protein kinase ephrin type A/B receptor-like | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCCCTGTTCGGGTCTGGCCGTCTGGGAAT |
Internal bar code: | GGATGTTCATGTACTGGTTGAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 365 |
LEAP-Seq percent confirming: | 98.4655 |
LEAP-Seq n confirming: | 385 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCAGCAAATATACGGGCACT |
Suggested primer 2: | CGCCTAGAAGAGACGACCAC |