| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.107477 |
| Chromosome: | chromosome 9 |
| Location: | 6250957 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g406400 | CTP3 | (1 of 2) K17686 - Cu+-exporting ATPase (copA, ATP7); Copper transporting ATPase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCATGGATGGATGTGTGGGAGGATGGATT |
| Internal bar code: | GTGGTGGGATCTTGCTAAGGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 668 |
| LEAP-Seq percent confirming: | 98.8913 |
| LEAP-Seq n confirming: | 2230 |
| LEAP-Seq n nonconfirming: | 25 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCAGAGGGGTTTTACGGTT |
| Suggested primer 2: | GGCCAGACTTAATATCGCCA |