| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.107521 |
| Chromosome: | chromosome 12 |
| Location: | 5607764 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g532000 | (1 of 3) PF04359 - Protein of unknown function (DUF493) (DUF493) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCTCGCACCCTCCTCGCTCAAAAGCGCAT |
| Internal bar code: | GCACTGATTATAACCGCCGAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 838 |
| LEAP-Seq percent confirming: | 93.2279 |
| LEAP-Seq n confirming: | 2946 |
| LEAP-Seq n nonconfirming: | 214 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGTAGGCTGGTGGGCTAAG |
| Suggested primer 2: | GCATGTACACGTTCCAGGTG |