| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.107562 |
| Chromosome: | chromosome 6 |
| Location: | 8065115 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g304500 | ZYS3-2,EZY9,ZYS4 | (1 of 2) PF00397//PF12796 - WW domain (WW) // Ankyrin repeats (3 copies) (Ank_2); Zygote-specific protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCCCTCAACTGCCACCTCTTCTTCGCCTC |
| Internal bar code: | TTAGTTGTTCACTCCGCTCCGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 9 |
| LEAP-Seq percent confirming: | 94.5946 |
| LEAP-Seq n confirming: | 35 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGCGTTGATGTACTTGATG |
| Suggested primer 2: | TTACCCACGAACTGGACACA |