| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.107596 |
| Chromosome: | chromosome_13 |
| Location: | 2380777 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Orientation | Feature |
|---|---|---|---|---|
| Cre13.g579450 | CST1 | Chlamy-specific membrane transporter of unknown function | antisense | 5'UTR |
Insertion site details | |
| Flanking sequence (orientation from cassette outwards): | GGGCGCTTTAATGACCGTAGCCGTTTATGT |
| Internal bar code: | CAGGCATGCCAATGGGAGCAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 405 |
| LEAP-Seq percent confirming: | 99.4338 |
| LEAP-Seq n confirming: | 1405 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATCCGGACTCACACTTGTCC |
| Suggested primer 2: | TTGGACATCTGGACGTGTGT |