Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.107682 |
Chromosome: | chromosome 6 |
Location: | 8424946 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g307100 | AKC2 | (1 of 2) PTHR10566//PTHR10566:SF72 - CHAPERONE-ACTIVITY OF BC1 COMPLEX CABC1 -RELATED // PROTEIN KINASE FAMILY PROTEIN; conserved protein related to ABC1/COQ8 putative ser/thr kinase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTCGACCGATGCCTAACAGCAATGAGGGT |
Internal bar code: | GAGTTGGGCGCGGTTTAAAGGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 584 |
LEAP-Seq percent confirming: | 98.7365 |
LEAP-Seq n confirming: | 1641 |
LEAP-Seq n nonconfirming: | 21 |
LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAGGCTCGTAGGTTACAGGC |
Suggested primer 2: | GTCTCGGTCACAGTTGAGCA |