| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.107692 |
| Chromosome: | chromosome 8 |
| Location: | 3639117 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g376350 | ASF1 | Anti-silencing factor; (1 of 1) K10753 - histone chaperone ASF1 (ASF1) | 5'UTR|outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCTCTTCACTGCCCGTCGCTCTTGTTCGG |
| Internal bar code: | AGACCAGAAAGGTTGTAAGTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 553 |
| LEAP-Seq percent confirming: | 98.9886 |
| LEAP-Seq n confirming: | 783 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGTAAGAGCAGGTGAGGAG |
| Suggested primer 2: | CGACTAGGATTTGCCAGAGC |