| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.107741 |
| Chromosome: | chromosome 4 |
| Location: | 1795475 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g211950 | ELG32 | Exostosin-like glycosyltransferase 32; (1 of 34) 2.4.2.41 - Xylogalacturonan beta-1,3-xylosyltransferase / Xylogalacturonan xylosyltransferase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTGATAGGAAATAGCCTGTCGCTCAAAAT |
| Internal bar code: | GCGCGTATGTAGTGGGACTAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 268 |
| LEAP-Seq percent confirming: | 96.8013 |
| LEAP-Seq n confirming: | 575 |
| LEAP-Seq n nonconfirming: | 19 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCAATGAAATGCATCGGTGT |
| Suggested primer 2: | CCATGGGATGGTGTGTATCA |