| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.107744 |
| Chromosome: | chromosome 12 |
| Location: | 9603421 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g549427 | (1 of 1) 1.17.4.2 - Ribonucleoside-triphosphate reductase / Ribonucleotide reductase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTTCCAAAGCAGTAACGCCCCTATGACCT |
| Internal bar code: | GGTAAGGTGGGTTCAGGCGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 452 |
| LEAP-Seq percent confirming: | 99.8146 |
| LEAP-Seq n confirming: | 1077 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCCAGGAGTGAGCATGAGT |
| Suggested primer 2: | TGGGTGTACGACCACTTTGA |