| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.107760 |
| Chromosome: | chromosome 7 |
| Location: | 5641754 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g352250 | HEL42 | (1 of 2) K14780 - ATP-dependent RNA helicase DHX37/DHR1 [EC:3.6.4.13] (DHX37, DHR1); DEAD/DEAH box helicase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGGGGATTGGGATTGGAGGTCGCGGCACA |
| Internal bar code: | CTGCCCTGGTCTAATAACCGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 105 |
| LEAP-Seq percent confirming: | 16.4948 |
| LEAP-Seq n confirming: | 80 |
| LEAP-Seq n nonconfirming: | 405 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCGTTTGCTCGAGACTTTTC |
| Suggested primer 2: | GGAGATCAACTTGAGCCAGC |