| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.107771 |
| Chromosome: | chromosome 12 |
| Location: | 5689104 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g532550 | RPL13A,RPL13a | Ribosomal protein L13a, component of cytosolic 80S ribosome and | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGCGCCTGGTGTAGGGTCCGGCGGCGCCA |
| Internal bar code: | GGGGAGACTGAATTGACCTCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 161 |
| LEAP-Seq percent confirming: | 98.4877 |
| LEAP-Seq n confirming: | 521 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGACACACATGAGGACAGCG |
| Suggested primer 2: | GTCCGTGTGACTTGGAGGTT |