| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.107864 |
| Chromosome: | chromosome 7 |
| Location: | 2057225 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g325762 | FAP82,FBB15,DRC11 | Nexin-dynein regulatory complex 11; (1 of 1) PF00004//PF00612 - ATPase family associated with various cellular activities (AAA) (AAA) // IQ calmodulin-binding motif (IQ) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCTGCGGGGTGCGGGGAGGGCCCCGAACA |
| Internal bar code: | GTCAGTATTGTCGTAAAGGTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 271 |
| LEAP-Seq percent confirming: | 97.8661 |
| LEAP-Seq n confirming: | 1330 |
| LEAP-Seq n nonconfirming: | 29 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCATACCGTATTGTGTGCCA |
| Suggested primer 2: | GCTCACTTCTTCTTGCCACC |