| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.107877 |
| Chromosome: | chromosome 3 |
| Location: | 8532833 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g201552 | MMP8 | Metalloproteinase of VMP family; (1 of 1) IPR003882//IPR008752//IPR013320 - Pistil-specific extensin-like protein // Peptidase M11, gametolysin // Concanavalin A-like lectin/glucanase domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTTGTGCCGATGCATGACCAAAGCAGCCG |
| Internal bar code: | GTAAGGGCGACTTCGGCTGTAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 591 |
| LEAP-Seq percent confirming: | 60.7897 |
| LEAP-Seq n confirming: | 3510 |
| LEAP-Seq n nonconfirming: | 2264 |
| LEAP-Seq n unique pos: | 30 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGGACAAGAACGGCAAAGA |
| Suggested primer 2: | CTGGAGAAGCCGTGGTAGAG |