| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.107954 |
| Chromosome: | chromosome 5 |
| Location: | 1977056 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g241640 | (1 of 1) IPR000253//IPR000859//IPR014710 - Forkhead-associated (FHA) domain // CUB domain // RmlC-like jelly roll fold | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGGCGCCCGGTGTCGTGGTCGTACACGCC |
| Internal bar code: | TACATTATCGTGTCGGTCGGAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1171 |
| LEAP-Seq percent confirming: | 99.1288 |
| LEAP-Seq n confirming: | 18092 |
| LEAP-Seq n nonconfirming: | 159 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGCAGCAGTAGTAGCACGC |
| Suggested primer 2: | GATACATAGAAGCGCACGCA |