Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.108055 |
Chromosome: | chromosome 16 |
Location: | 5614494 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g679800 | (1 of 2) PTHR17630//PTHR17630:SF43 - DIENELACTONE HYDROLASE // SUBFAMILY NOT NAMED | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTCGGGCTGCGAGTAGAAGGCATCACGCA |
Internal bar code: | GGGAGGCATGTGAGGTTGGGAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 700 |
LEAP-Seq percent confirming: | 97.8408 |
LEAP-Seq n confirming: | 1450 |
LEAP-Seq n nonconfirming: | 32 |
LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GATTCGTTGGTCGCTGAAAT |
Suggested primer 2: | GGGCTCATAGGTCGATACCA |