| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.108099 |
| Chromosome: | chromosome 17 |
| Location: | 1052883 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g703750 | (1 of 1) PF14222 - Cell morphogenesis N-terminal (MOR2-PAG1_N) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCCTCCTCCCCAGGAGAACCTGGTTGCGC |
| Internal bar code: | GGTGGTCGAATGGGAGCGAGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 687 |
| LEAP-Seq percent confirming: | 98.9726 |
| LEAP-Seq n confirming: | 2312 |
| LEAP-Seq n nonconfirming: | 24 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACAAGAATGCCAGGTCCAT |
| Suggested primer 2: | CGCAAGGGACTTGCTTAGAC |