| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.108110 |
| Chromosome: | chromosome 9 |
| Location: | 1121875 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g400312 | (1 of 5) IPR001680//IPR011047//IPR017986 - WD40 repeat // Quinonprotein alcohol dehydrogenase-like superfamily // WD40-repeat-containing domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGGCACCTAGCTAAGAGCGAACAAGTACA |
| Internal bar code: | TGTCTGCCCTTGACTCCCTGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 476 |
| LEAP-Seq percent confirming: | 57.5676 |
| LEAP-Seq n confirming: | 639 |
| LEAP-Seq n nonconfirming: | 471 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACACACACACACACACACGG |
| Suggested primer 2: | GCCTGGTGCAGAAGAAGAAC |