| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.108230 |
| Chromosome: | chromosome 14 |
| Location: | 2524952 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g625350 | MAE17 | MATE efflux family protein; (1 of 3) PTHR11206:SF95 - MULTI ANTIMICROBIAL EXTRUSION FAMILY PROTEIN | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAGTGGTGGGAGTACGGCGAGCAGGCGGT |
| Internal bar code: | TATGACGCTGTCGTCCGAATCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 528 |
| LEAP-Seq percent confirming: | 95.5556 |
| LEAP-Seq n confirming: | 86 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGGTCTGGGTCTAGGTTTG |
| Suggested primer 2: | GCAACCGACGTTTACCCTAA |