Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.108286 |
Chromosome: | chromosome 17 |
Location: | 5679619 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g738632 | RLS13 | RegA/RlsA-like protein; (1 of 10) IPR010919 - SAND domain-like | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTACCGTGCTACACACACAGCGAGACCCTT |
Internal bar code: | CCCCTGGGTAGGCGTGACCCCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 132 |
LEAP-Seq percent confirming: | 99.9201 |
LEAP-Seq n confirming: | 1250 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGGGTATCCCCTGATTGGTA |
Suggested primer 2: | GCGACGTTGGTAAGTACGGT |