| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.108290 |
| Chromosome: | chromosome 2 |
| Location: | 5220171 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g105950 | FAP174 | (1 of 1) PTHR13168//PTHR13168:SF0 - ASSOCIATE OF C-MYC AMY-1 // C-MYC-BINDING PROTEIN; Flagellar Associated Protein 174 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACTCCCATCGCAGAGCACGAAATGTCTGC |
| Internal bar code: | TGGGCTGATGGTTGTATAGGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 657 |
| LEAP-Seq percent confirming: | 99.1154 |
| LEAP-Seq n confirming: | 2465 |
| LEAP-Seq n nonconfirming: | 22 |
| LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGAACATGCCCTTTTTGGTG |
| Suggested primer 2: | GCTCGTCAAGGGTAAGCAAC |