Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.108378 |
Chromosome: | chromosome 2 |
Location: | 2001792 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g088450 | CPLD29 | Conserved in the Plant Lineage and Diatoms; (1 of 1) PTHR22999:SF18 - PX DOMAIN-CONTAINING PROTEIN KINASE-LIKE PROTEIN | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAACGAACGGCGTCGGTGGCGTGACGAATG |
Internal bar code: | GTCAGCCGTGAAGCACACGGTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 566 |
LEAP-Seq percent confirming: | 99.197 |
LEAP-Seq n confirming: | 3212 |
LEAP-Seq n nonconfirming: | 26 |
LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGGCTACGCCTTCACTTCTT |
Suggested primer 2: | GATGGCTGCTCTTTGTGTGA |