| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.108424 |
| Chromosome: | chromosome 3 |
| Location: | 5613211 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g187000 | (1 of 1) PF12325//PF12329 - TATA element modulatory factor 1 TATA binding (TMF_TATA_bd) // TATA element modulatory factor 1 DNA binding (TMF_DNA_bd) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTCGTCCGCCCTCCCTGCAAACCCACGCA |
| Internal bar code: | CGGTGTGCTACTAGCGACGGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 693 |
| LEAP-Seq percent confirming: | 98.9305 |
| LEAP-Seq n confirming: | 1110 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCCGACAGGACCTACAAGC |
| Suggested primer 2: | AATGGAGTGGAGTGAGGTGG |