Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.108458 |
Chromosome: | chromosome 3 |
Location: | 8200958 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g200050 | CAL1 | (1 of 2) PF13202//PF13833 - EF hand (EF-hand_5) // EF-hand domain pair (EF-hand_8); Calpain family cysteine protease | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATCACCCTTGACTTCAACCAGTGGGTGTA |
Internal bar code: | GCGGGGAAACTCATGCCGGCGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 817 |
LEAP-Seq percent confirming: | 99.5098 |
LEAP-Seq n confirming: | 2436 |
LEAP-Seq n nonconfirming: | 12 |
LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGTTACATCACGGCATGTTC |
Suggested primer 2: | CACCGTACACGACAAAATCG |