Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.108578 |
Chromosome: | chromosome 8 |
Location: | 4485542 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g382515 | (1 of 1) PTHR22838//PTHR22838:SF0 - WD REPEAT PROTEIN 26-RELATED // WD REPEAT-CONTAINING PROTEIN 26 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCGCCTGCTCCCCTCCCACACACCCCACA |
Internal bar code: | TGGGTGCCACAGGTGTGATGCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 440 |
LEAP-Seq percent confirming: | 90.8974 |
LEAP-Seq n confirming: | 152175 |
LEAP-Seq n nonconfirming: | 15239 |
LEAP-Seq n unique pos: | 179 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTCGCAGCAATACAAAGCAA |
Suggested primer 2: | AACACGCTTCACCTTGCTTT |